For AU-capped RNA and saRNA workflows
Prima RNApols® Cap AU
Prima RNApols® Cap AU is designed for AU-capped RNA and self-amplifying RNA workflows where capping efficiency, yield, dsRNA reduction, and RNA integrity shape IVT performance. It supports cleaner IVT output and more efficient RNA synthesis with lower cap analog, DNA template, and enzyme requirements.
Contains the following:
- 20,000 U RNA Polymerase (100 µL)
- 9.5 kb Linearized saRNA Template (25 µL)
- 5x Reaction Buffer (100 µL), 4 vials
For Research Use Only (RUO)
$349.00
For GMP, bulk orders, or formal quotations, please submit your request.
Performance Data
AU Capping with Reduced Cap Analog Input
Capping efficiency on 9.5 kb saRNA determined by LC-MS; 4 nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT.
Ultra-Low dsRNA + Higher Purity
Capping efficiency on 9.5 kb saRNA determined by LC-MS; dsRNA determined by J2 ELISA; 4 nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT, 2 mM cap analog.
High Yield with Less DNA Template & Enzyme Inputs
Yield determined by A260 on 9.5 kb saRNA; integrity determined by Agilent Fragment Analyzer; capping efficiency determined by LC-MS; dsRNA determined by J2 ELISA; 4 nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT, 2 mM cap analog.
Technical Resources
FAQs
What is the Prima RNApols® Cap AU promoter sequence?
TTGATTAATTAACCCACACTATAATG
Will Prima RNApols Cap AU work with the T7 promoter?
No, Cap AU is only compatible with the Cap AU promoter. The specific promoter sequence must be incorporated into the DNA template of interest to successfully generate mRNA during in vitro transcription (IVT). For information about this process, refer to the Use Guide or contact Primrose for support.
Will the Prima RNApols Cap AU work with any transcription start site (TSS)?
Cap AU is an engineered enzyme optimized for co-transcriptional capping with AU cap analogs. However, Cap AU is also compatible with other cap analogs and transcription start sites.
Can I use my preferred capping strategy?
Cap AU is optimized for AU co-transcriptional capping, significantly improving efficiency and reducing reagent use for saRNA templates.
Can I use the mRNA made from the Cap AU kit DNA template for cellular expression?
No, this template DNA is meant to be used as a kit control for mRNA yield only.
Still have questions? Contact our team
RUO Kits Today. Established capabilities to support your GMP manufacturing as programs advance.
Contact Us
Explore Our Full Range of RNApol Solutions
Product purchased through this website is for purchaser’s internal research use only and any other use is prohibited except pursuant to a separate agreement between Primrose Bio and purchaser expressly permitting such other use.