For AG-capped workflows
Prima RNApols® Cap AG
Prima RNApols® Cap AG is designed for AG-capped RNA workflows where teams can optimize template design for premium performance, delivering robust results across template and UTR designs.
Contains the following:
- 20,000 U RNA Polymerase (100 µL)
- 2 kb Linearized DNA Template (25 µL)
- 5x Reaction Buffer (100 µL), 4 vials
$349.00
For GMP, bulk orders, or formal quotations, please submit your request.
Performance Data
Translatability
Translatability of 1.3 kb GFP template measured by fluorescence. The same amount of RNA generated by either polymerase was transfected.
AG Capping with Lower Cap Input
Ultra-low dsRNA
Capping efficiency determined by LC-MS; dsRNA determined by dot-blot; similar IVT conditions used for each IVT.
Yield determined by A260; Integrity determined by fragment analyzer; similar IVT conditions used for each IVT.
Technical Resources
FAQs
What is Prima Cap AG?
Prima Cap AG is an RNA polymerase designed for AG-capped RNA workflows. It supports strong translatability, high-efficiency capping with reduced cap analog input and ultra-low dsRNA.
What is the Prima Cap AG promoter sequence?
TAAGTGAACAATACGACTCACTATT
How do I incorporate the Prima Cap AG promoter sequence into my DNA Template?
The promoter can be incorporated through PCR or through cloning into plasmid DNA. Detailed instructions to do this can be found in the instructions for use.
What transcription start site should I use?
Prima Cap AG is designed for AG-capped workflows, with a transcription start site of AG.
What improvement in translatability can I expect?
RNA produced with Prima Cap AG showed up to 3x higher translatability than T7-produced RNA in a reporter assay with equal RNA input. Performance was measured as the area under the protein-expression curve.
What level of capping efficiency can I expect?
Prima Cap AG can achieve >97% co-transcriptional AG capping efficiency with only 2 mM cap concentration with 9 mM NTP concentrations. Capping efficiency depends on the template and IVT conditions.
Can Prima Cap AG reduce capping reagent requirements?
Yes. Prima Cap AG is designed to achieve high capping efficiency with 2 mM AG cap in manufacturing-like IVT conditions with high concentration of NTPs, helping reduce IVT reagent costs. The appropriate cap input should be established through workflow-specific optimization.
Can I use my preferred capping strategy?
Prima Cap AG is designed for co-transcriptional capping with AG cap analogs. For AU-capped workflows, consider Prima Cap AU or Prima 7 Pro, based on your template design and process needs.
What type of yield can I expect?
Prima Cap AG supports high RNA yield across AG-compatible templates and UTR designs. Yield and RNA integrity vary by construct, so template-specific optimization is recommended.
What about dsRNA? How does this enzyme perform?
Prima Cap AG supports >100x dsRNA reduction relative to T7. The degree of reduction depends on the template and reaction conditions.
Has Prima Cap AG been tested with modified RNA?
Yes. Testing has been performed with m1ψ on constructs ranging in size from 1.3 to 9.5 kb. Confirm performance with your selected sequence and nucleotide chemistry.
Is GMP-grade enzyme supply supported?
Prima Cap AG kits are for research use only (RUO), supporting R&D and process development. Primrose Bio has established capabilities to supply GMP-grade RNA polymerases as programs advance.
How do I choose between Prima Cap AG, Prima 7 Pro, and Prima Cap AU?
Choose Prima Cap AG for AG-capped workflows where template design can be optimized and translatability and capping efficiency are priorities. Choose Prima 7 Pro to retain existing T7-promoter DNA templates with AG and AU capping flexibility. Prima Cap AU is designed for AU-capped workflows with template design flexibility, high capping efficiency and ultra-low dsRNA.
How does Primrose recommend purifying RNA made with the Cap AG kit?
After DNase treatment, we recommend standard lithium chloride (LiCl) precipitation.
Still have questions? Contact our team
RUO kits today. Established capabilities to support your GMP manufacturing as programs advance.
Contact Us
Explore Our Full Range of RNApol Solutions
Product purchased through this website is for purchaser’s internal research use only and any other use is prohibited except pursuant to a separate agreement between Primrose Bio and purchaser expressly permitting such other use.