Prima RNApols ExTend Resources

Prima RNApols™ ExTend Kit

Prima RNApols™ ExTend GMP-grade

Saftey data sheet for both products can be found at the link below:

FAQs

What is the Prima RNApols™ ExTend promoter sequence?

TTGATTAATTAACCCACACTATAGGG

Will the Prima RNApols™ ExTend kit work with the T7 promoter?

No, the Prima RNApols ExTend polymerase is only compatible with the Prima RNApols ExTend promoter. This sequence must be incorporated into the DNA template of interest to successfully generate mRNA during in vitro transcription (IVT). 

Will the Prima RNApols™ ExTend kit work with any transcription start site (TSS)?

Yes, Prima RNApols ExTend is compatible with multiple TSSs. Performance is sequence dependent and may require IVT optimization.  

Can I use my preferred cap analogue with this kit?

Yes, Prima RNApols ExTend is compatible with both co- and post-transcriptional capping strategies.  Performance is sequence dependent and may require IVT optimization. 

Will I get better utilization out of my DNA template? 

Yes, based on our DNA template titration results we see improved yield per unit template.

Contact us for any questions