Long-template mRNA synthesis

Prima RNApols™ ExTend is an innovative RNA polymerase engineered to address challenges in the in vitro transcription (IVT) manufacturing of mRNA.

Prima RNApols™ ExTend Kit

Contains the following for 50 IVT reactions:

20,000 U RNA Polymerase (100 µL)
4, 5x Reaction Buffer (100 µL)
2 kb Linearized DNA Template (25 µL)

For Research Use Only (RUO)

$349.00

Prima RNApols™ ExTend GMP-grade¹

Contains 20,000 U RNA Polymerase (100 µL)

¹GMP-grade Prima RNApols are manufactured and released under ISO 13485:2016 certified quality systems, available for clinical and commercial mRNA manufacturing.

$229.00

Prima RNApols™ ExTend GMP-grade¹ – Large

Contains 2,000,000 U RNA Polymerase (10 mL)

¹GMP-grade Prima RNApols are manufactured and released under ISO 13485:2016 certified quality systems, available for clinical and commercial mRNA manufacturing.

$349.00

For GMP, bulk orders, or formal quotations please submit your request. Our team will get back to you as soon as possible.

Key Features & Benefits

High-Quality, High-Purity mRNA
Generates long-template mRNA with superior integrity compared to T7 polymerase.

Ultra-Low dsRNA
Minimizes unwanted byproducts, reducing immune response risks and improving the safety and effectiveness of mRNA therapeutics and vaccines.

Maximized Yield with Less Input
Increases mRNA output while using less DNA template, lowering costs and streamlining the manufacturing process.

Compatibility with Various mRNA Structures
Supports diverse mRNA modalities and modified nucleotides.

Seamlessly transition from discovery to clinical applications.

Total yield was determined using a fluorescence assay. mRNA purity was determined using IP-RP-HPLC for 10kb mRNA with UTP. Similar results observed using N1-methylpseudouridine.

dsRNA levels were determined using the J2-based ELISA kit for 10kb mRNA with UTP. Similar results observed using N1-Methlypseudouridine.

IP-RP-HPLC shows that Prima RNApols ExTend controls aborted sequences as compared to T7 for 10 kB template.

What is the Prima RNApols™ ExTend promoter sequence?

TTGATTAATTAACCCACACTATAGGG

Will the Prima RNApols™ ExTend kit work with the T7 promoter?

No, the Prima RNApols ExTend polymerase is only compatible with the Prima RNApols ExTend promoter. This sequence must be incorporated into the DNA template of interest to successfully generate mRNA during in vitro transcription (IVT). 

Will the Prima RNApols™ ExTend kit work with any transcription start site (TSS)?

Yes, Prima RNApols ExTend is compatible with multiple TSSs. Performance is sequence dependent and may require IVT optimization.  

Can I use my preferred cap analogue with this kit?

Yes, Prima RNApols ExTend is compatible with both co- and post-transcriptional capping strategies.  Performance is sequence dependent and may require IVT optimization. 

Will I get better utilization out of my DNA template? 

Yes, based on our DNA template titration results we see improved yield per unit template.

Contact Us

Explore Our Full Range of RNApol Solutions

Product purchased through this website is for purchaser’s internal research use only and any other use is prohibited except pursuant a separate agreement between Primrose Bio and purchaser expressly permitting such other use.