Self-Amplifying mRNA Synthesis

Cap AU enables high-yield, fully capped self-amplifying mRNA using less reagents in every in vitro transcription (IVT) reaction. Built specifically for AU cap analogs, dsRNA reduction combined with lower reagent needs delivers higher quality, more cost-effective mRNA. 

Prima RNApols® Cap AU Kit

Contains the following:

  • 20,000 U RNA Polymerase (100 µL)

  • 9.5 kb Linearized saRNA Template (25 µL)

  • 5x Reaction Buffer (100 µL), 4 vials

For Research Use Only (RUO)

SEE DETAILS

Expanding on our innovative RNA polymerases, Prima RNApols™ ExTend Cap AU is designed to maximize yield and capping efficiency during in vitro transcription (IVT) of self-amplifying mRNA. Achieve higher-quality mRNA with less dsRNA than T7. The efficient use of IVT reagents enables reductions in mRNA manufacturing costs.

$349.00

For GMP, bulk orders, or formal quotations, please submit your request.

                  Capping efficiency on 9.5 kb saRNA determined by LC-MS; 4nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT

           Capping efficiency on 9.5 kb saRNA determined by LC-MS; dsRNA determined by J2 ELISA; 4nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT, 2 mM cap analog

Yield was determined using A260 on 9.5 kb saRNA; Integrity was determined using Agilent Fragment Analyzer; Capping efficiency determined by LC-MS; dsRNA determined by J2 ELISA; 4nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT,
2 mM cap analog

What is the Prima RNApols® Cap AU promoter sequence?

TTGATTAATTAACCCACACTATAATG

Will Prima RNApols Cap AU work with the T7 promoter?

No, Cap AU is only compatible with the Cap AU promoter. The specific promoter sequence must be incorporated into the DNA template of interest to successfully generate mRNA during in vitro transcription (IVT). For information about this process, refer to the Use Guide or contact Primrose for support.

Will the Prima RNApols Cap AU work with any transcription start site (TSS)?

Cap AU is an engineered enzyme optimized for co-transcriptional capping with AU cap analogs. However, Cap AU is also compatible with other cap analogs and transcription start sites.

Can I use my preferred capping strategy?

Cap AU is optimized for AU co-transcriptional capping, significantly improving efficiency and reducing reagent use for saRNA templates.

Can I use the mRNA made from the Cap AU kit DNA template for cellular expression?

No, this template DNA is meant to be used as a kit control for mRNA yield only.

Seamlessly transition from discovery to clinical applications.

Contact Us

Product purchased through this website is for purchaser’s internal research use only and any other use is prohibited except pursuant a separate agreement between Primrose Bio and purchaser expressly permitting such other use.