Self-Amplifying mRNA Synthesis
ExTend Cap AU enables high-yield, fully capped self-amplifying mRNA using less reagents in every in vitro transcription (IVT) reaction. Built specifically for AU cap analogs, dsRNA reduction combined with lower reagent needs delivers higher quality, more cost-effective mRNA.
Prima RNApols™ ExTend Cap AU
Contains the following:
- 20,000 U RNA Polymerase (100 µL)
For Research Use Only (RUO)
SEE DETAILS
Expanding on our innovative RNA polymerases, Prima RNApols™ ExTend Cap AU is designed to maximize yield and capping efficiency during in vitro transcription (IVT) of self-amplifying mRNA. Achieve higher-quality mRNA with less dsRNA than T7. The efficient use of IVT reagents enables reductions in mRNA manufacturing costs.
$229.00
Key Features & Benefits
High AU Capping Efficiency
Achieve high capping efficiency with less cap, lowering reagent requirements.
Ultra-Low dsRNA
Minimize unwanted IVT byproducts, reducing downstream purification needs and improving the safety and performance of mRNA therapeutics.
High Yield of Self-Amplifying RNA
Maximizes yield while maintaining integrity and fidelity compared to T7 polymerases
Cost-Efficient Manufacturing
Use less template, enzyme, and cap analog for significant cost savings.
Seamlessly transition from discovery to clinical applications.
Capping efficiency on 9.5 kb saRNA determined by LC-MS; 4nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT


Capping efficiency on 9.5 kb saRNA determined by LC-MS; dsRNA determined by J2 ELISA; 4nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT, 2 mM cap analog

Yield was determined using A260 on 9.5 kb saRNA; Integrity was determined using Agilent Fragment Analyzer; Capping efficiency determined by LC-MS; dsRNA determined by J2 ELISA; 4nM DNA template, 9 mM NTPs, 5 U polymerase/µL IVT,
2 mM cap analog
What is the Prima RNApols™ ExTend Cap AU promoter sequence?
TTGATTAATTAACCCACACTATAATG
Will Prima RNApols ExTend Cap AU work with the T7 promoter?
No, Prima ExTend Cap AU is only compatible with the Prima ExTend Cap AU promoter. The specific promoter sequence must be incorporated into the DNA template of interest to successfully generate mRNA during in vitro transcription (IVT). For information about this process, refer to the Use Guide or contact Primrose for support.
Will the Prima RNApols ExTend Cap AU work with any transcription start site (TSS)?
ExTend Cap AU is an engineered enzyme optimized for co-transcriptional capping with AU cap analogs. However, ExTend Cap AU is also compatible with other cap analogs and transcription start sites.
Can I use my preferred capping strategy?
Prima ExTend Cap AU is optimized for AU co-transcriptional capping, significantly improving efficiency and reducing reagent use for saRNA templates.
Contact Us
Explore Our Full Range of RNApol Solutions
Product purchased through this website is for purchaser’s internal research use only and any other use is prohibited except pursuant a separate agreement between Primrose Bio and purchaser expressly permitting such other use.
